Uyghur Xelq Küyliri

Loading...

Thursday, August 30, 2012

Yighlaymen - Sobbing

Yighlaymen - Sobbing

Yighlaymen ultra awazda,
Undin özgige ne amalim bar?!

I am sobbing with Ultrasound,
Because no other way can I found!

Tuesday, March 6, 2012

Uyghur Zamani

Uyghur Zamani

*

I.N. Aptap

ئۇيغۇر زامانى

Uyghur Zamani ____

          Uyghurlar dunyada keng tonulidighan zaman;

          Uyghur naxsha-küyliri jahanda keng tarqilidighan, moda bolidighan zaman;

          Uyghurlar yashawatqan zimin qaytidin Jahan Bazarigha aylinidighan zaman!

*

      Uyghurlar gerche Junggoda bir "azsanliq millet" bolsimu, biraq, Dunya miqyasidiki 5000din artuq tilda sözlishidighan milletler (buning ichide "millet" dep étirap qilin'ghinimu 2000din artuq) arasida 50 nechchinchi orunda turidu. 

      Uyghurlar uzaq zamanlardin tartip ichkiy quruqluqta, yeni, dengizdin yiraq, ahale tarqaq (buni bir tereptin shu zimindiki nisbiy su azliq, ikkinchidin köchmen turmush belgeligen) bolghan sharaitta yashap kelgen. Yashash muhitidiki asansizliq we turmushtiki yalghuzluq Uyghur xelqini neghme-nawagha hérismen qilghan. Buni chüshinish nahayiti asan __ müshkül turmush muhiti we keng zimin ata qilghan yalghuzluq tuyghusi bilen toxtimay küresh qilishqa giriptar xelqimiz, peqet naxsha-küyler arqiliqla özining psixikasini tengshiyeleydu! Hetta Uyghurlar Islam dinigha kirishtimu, "Neghme-nawa we bashqa sen'et türliridin qol üzmeslik"ni shert qilip kirgen iken. Shunga Uyghurlar sanaqsiz güzel küylerning sahibidur, bolupmu Uyghur Xelq Naxshaliri uzun zamanlarda xelqning üzlüksiz ilghashi, mukemmellishidin ötken. 

      Ademning iqtidari köp tereplimelik bolup, ashu köp iqtidarlar ichide eng yuquri derijede tereqqiy qilghan melum bir yaki ikki xil iqtidar, kishini jemiyetke tonutidu. Melum bir milletmu, oxshashla, özidiki alahide xislet-iqtidar arqiliq jahan'gha tonulidu. Uyghurlarni dunyagha tonutidighan "milliy iqtidar"larning biri, hich bolmighanda bügünki ehwalimizda, elwette naxsha-muzikadur! Yaqinqi bir mezgilde, naxsha-küylirimizde mung terkibi artip ketti, urghup turghan roh kemip ketti, buning sewebi hemmege ayan! Biraq, rohiyetimizni urghitish üchün, naxsha-küylirimiz yenela aldida mangishi zörürdur! (Qaysi bir jhornaldin körishimche, yol yaqasida yatip qalghan, yardemge muhtaj bir kishige kim qol sunidu? dégen sualning A, B ikki xil jawabidin, B jawap toghra bolidiken: A. Yénik musika anglap keliwatqan bir yigit; B. Jez muzikasi anglap keliwatqan bir yigit.) Rohiyetimizni urghitayli!

      Millitimizning yene bir iqtidari __ soda-sartiq ishliri __ bolup, bu xil iqtidar tarixta bir mehel millet nami "Sart"ning ishlitilishigimu sewep bolghan.

      Elwette, bu ikki milliy iqtidarning tughma ipadelinish sewiyesi bilen mesile hel bolmaydu! Buning üchün choqum kichikidin sistémaliq terbiye körgen, hazirqi zaman kespiy bilimliri bilen qorallan'ghan bir top sen'etkarlirimiz, sodagerlirimiz, karxanachilirimiz bolushi kérek! 

      Ejdatlirimiz yashighan zimin "Yipek Yoli"ning merkezige __ dengiz qatanashi téxi achilmighan, insanlar öz'ara alaqe we soda munasibetliridiki birdin bir yol, quruqluq yoli, bolghan ashu zamanlardiki Asiyawropa quruqliqining merkezige __ jaylashqan. Bu xil ehwal, eyni zamanda, Ziminimizning Xelq'ara Bazar bolush teghdirini belgeligen.

      Dunyada dengiz qatnashining omumlishishigha egiship, tennerxi töwen, yük toshush miqdari yuquri bolghan Dengiz Soda Yolining shekillinishi bilen, eslidiki "Quruqluq Xelq'ara Bazari" tarqap ketken. 

      Quruqluq qatnashi qaytidin ewzellik körsetishke bashlighan, hawa qatnashi toluqlima rol oynap, kishilerning menzilge yetmeki asanlashqan, hetta Yershari bir "kent"ke aylan'ghan bügünki künde, Ziminimizde "Quruqluq Xelq'ara Bazari"ning qaytidin ronaq tapishi bir muqererliktur.

      Zaman bizni kütmekte!

      Undaqta, biz shu Uyghur Zamani üchün teyyar bolduqmu?


Wednesday, December 21, 2011

Alem Yaziqi


Alem Yaziqi

Ilham Nizam (2011.12.21)

CGACUCACUAGACGACCCUCCCUAAACAUACAUAGCUCCCGACUGCGAAUUUCCCCUAAACCCAGCCUACAUAAAUAAUCCCAGAAACCCAUAAAACAUUCCAUCAACACAAACAUUAGCCUCAACCCUAGUAACUCCAGCACUAACUCCCGAAUACGAACUAGAUCCCUAAACAUACAUUAC

      Bu yaziqni oquyalidingizmu?
      Eger siz Biologiye oqughan kishi bolghiningizda, bu yaziqni tonuysiz __ Yersharidiki barliq janliqlarda ortaq ishlitilgen Irsiy Kod (Genetic Code)! Biraq siz uni oqup chüshinelishingiz mumkin emes, chünki u bir yaziq bolush süpetide emdila wujutqa keldi, u del men sizge deyishke aldirawatqan Alem Yaziqi! 
      Yuquriqi Kod yaziqning örümesi mundaq:
      Uyghur xälqi uzun tarixqa, parlaq mädäniyätkä igä ulugh xälq!
      Hemmemizge melum, 2012- yil __ "Zaman Axiri Yili" __ kirish aldida turidu. Qedimki Maya Medeniyetidin qalghan Palsözi boyiche bolghanda, 2012- yil 12- ayning 21- küni "Zaman Axiri Küni"dur. "Zaman Axiri" __ Alemdiki, bolupmu Yersharimizdiki, barliq janliqlarning hemde Insanlar yaratqan Medeniyet Jughlanmasining axirqi nuqtasi, hich bolmighanda ashundaq bolush ehtimalliqi nahayiti chong. 
      "Alem Büyük Partlash Nezeriyesi" boyiche, Alem eslide massasi ghayet zor, hejmi ghayet kichik (kichiklikte uni bir "nuqta" dep qarash mumkin) bir Jisimning partlishidin hasil bolghan bolup, Alemdiki planet-metoritlar ene shu partlashtin chiqqan Jisim parcheliri we tozanliridin ibarettur; Alemdiki shu parche-tozanlar haman bir küni bashqadin yighilip, heliqi "Nuqta Jisim"ni qayta hasil qilghusidur, xuddi biz chüshineleydighan uqumdiki Asman'gha atilghan tash haman Yeryüzige qaytip chüshkinige oxshash!
      "Nuqta Jisim" hasil bolghamda, elwette, "Alem Axiri" bolidu. Insanlarning "Alem Axiri"ni bashtin kechürishi mumkin emes. Biraq "Zaman Axiri", yeni Yersharimizning talapetke uchrishi, Yershari tarixida nurghun qatim yür bergen ishtur. 2011- yilda "Zaman Axiri" kelmeydighan teghdirdimu, Kelechekte Insanlar uni choqum bashtin kechüridu! Nurghun pakitlar Yershari tarixida 4-5 qatim "Zaman Axiri" yüz bergenlikidin bisharet beridu. Peqet Insanlar, yaki aldinqi zamandiki Insanlar, özliri yaratqan medeniyetni xatirelesh üchün yaxshi bir waste tapalmighanliqtin, biz burunqi "Zaman Axiri" toghriliq aniq melumatqa ige bolalmighan bolushimiz mumkin, we yaki bolmisa, Aldinqi Medeniyet Yaratquchilar qaldurghan yazma materiallarni biz texi chüshinelmigen bolushimizmu mumkin!?!
      Yersharidiki barliq janliqlar irsiyet qaldurushta Nukleik Kislata (Yadro Kislata = Orda Kislata)din, yeni DNA we RNA'lardin paydalinidu. Maqalening bashidiki Kod yazma "RNA yaziqi" bolup, bu xil yaziq janliqlarda DNA'din köchürüp kelin'gen, öz nöwetide "RNA yaziqi" janliqlardiki xilmu-xil aqsil-peptidlar we nurghun hormonlarning yasalishi üchün rejhissorliq qilidu __ Orda Kislatadiki tört xil nukleotid (A, U, C, G) üch-üchtin gruppalinip, jemiy 64 xil kodni teshkil qilidu, yeni 64 xil menani ipade qilalaydu. (Biraq, aqsillarni sintezlash üchün 20 xil Amino Kislata ishlitilgen, shunga "Aqsil Yasash Zawuti"da ikki xil, hetta köp bolghanda alte xil kod bir xil Amino Kislatani ipade qilidighan ehwalmu mewjut.)
      Undaqta, janliqlar irsiyeti üchün ishlitilgen "64 herplik yaziq"ni insanlar medeniyetini xatirelesh üchün ishlitishke bolamdu? 
      Meningche bolidu!
      Töwendikisi 64 xil belgedin tüzülgen "Alem Yaziqi":
     Eger biz insanlar medeniyetining jewherlirini ashu "64 herplik yaziq" bilen yazip teyyarlisaq, u halda bir yürüsh RNA yaki DNA zenjirlirige erishimiz; andin bu zenjir molekulalarni her xil janliqlarning, bolupmu mikro organizmlarning Genomi (gen gruppasi)gha qoshuwetsek bolidu. "Zaman Axiri" yüz bergen teghdirdimu, bu xil "irsiy yaziq"tiki mezmunlar saqlinip qalishi mumkin. Chünki, "Zaman Axiri" bolghanda haman bir qisim maslishishchanliqi yuquri janliqlar yoqap ketmey, Yershari üchün "hayat uruqi" bolup qepqalidu. Shundaq bolghanda, men bu maqalide "Alem Yaziqi" dep atighan 64 herplik irsiy yaziq, Insanlar bu xil yaziq bilen yazishqa ülgürgen uygharliqlarni Keyinki Insanlar (yeni, "Zaman Axiri"din keyin bashqidin Darwinning "Tedrijiy Tereqqiyat Telimati" boyiche barliqqa kelgen eqil igeliri)ge yetküzüp berishke xizmet qilishi mumkin. [Janliqlar Genomida hazirche "roli yoq" dep qaralip, "gen qumluqi (gene deserts, 基因沙漠)" dep nam berilgen DNA bölekliri bar. Shu Gen Qumluqliri rastinla qumluqtek kereksizmu? Yaki Aldinqi Insanlar qaldurup ketken medeniyet izlirimu!?]
      Eger Maya Palsözi rast bolsa (undaq bolmighay!), undaqta Insanlarning mushu yaziq arqiliq öz medeniyetini "Zaman Axiri"ning sinaqlirigha berdashliq bereleydighan qilip qaldurmaqi üchün aran bir yil (Ötüp ketken bügünni chiqiriwetsek 364 kün) waqt qaldi! 
      Yene bir gep: Bu Alem Yaziqi bilen dunyadiki herplik yaziqlarning hemmesini yazghili bolidu __ peqetla Xensochini yazghili bolmaydu. 
__ Undaqta "mol-bay-sehirlik" Junghwa medeniyetini qandaq qaldurush kerek? 
__ Buning ishi asan __ barliq Xensoche medeniyet bayliqlirini Englishchigha terjime qilsa bolidughu!
__ Nede uche köp terjiman!?
__ Bolmisa, terjiman yetmigen qismini Uyghurchigha terjime qilghuzsa bolidu, "Qoshtilliq Maarip"ni bikargha yolgha qoymighandu?! Hazir, büshüktiki balalarni hisapqa almighandimu, boway-momaylar qoshulup az degende 15 milyon terjiman teyyar!

Friday, October 28, 2011

Yershari Ependi - Mr. Earth

Yershari Ependi


I. N. Aptap


Insanlar jemiyetining tereqqiy qilishigha ergeship, Yersharining ixtisadiy jehettin bir pütün gewdelishiwatqanini hemmemiz bilimiz, hemde mas halda "Yershari Kenti" degen isimni otturagha chiqarip ishletkimu xeli uzun boldi; Yene bir tereptin, Insanlarning Xelqara mesilelerni hel qilishtiki pikir ortaqliqlirining shekillinishi, Internet torigha oxshash uchur wasitelirining kamalet tapishi bilen, Yersharimiz xuddi bir organizmgha aylanip barmaqta...

Organizmgha aylan'ghan bu planetimizni "Yershari ependi" dep atap turayli (Burun uni "Bioearth" depmu atighan idim). Yershari ependining herqaysi organik ezaliri alliburun shekillinishke bashlighan...

Amerika Qoshma Shtatliri & Canada - Chong minge (Mukemmel qanun we demokratik ijtimaiy muhit arqaliq, bu ikki döwlet dunyadiki eng ilghar eqliy küchlerni özige tartip turidu)

En'giliye - Minge asti bezi (Bu döwlet gerche zimin jehettin nahayiti kichik bolsimu, biraq dunyadiki eng ilghar idiyelerning böshükidur)

Yehudilar - Bez (Hormon) (Yehudilar dunyaning hemme jayigha degüdek tarqalghan bolup, ular özining tirishchanliqi we eqil-pareseti bilen her jaylarning ixtisadiy we ijtimaiy tereqqiyati üchün zor töhpilerni qoshqan, xuddi adem tenidiki hormonlargha oxshash)

Erebiye & Iran - Jiger (Dunya neft zapasining 60%i mushu rayon'gha mujessem)

Hindistan & Junggo - Börek (Ahalisi alahide köp bolghan bu ikki döwlet, qandaqla qilishidin qet'iy nezer, maddiy bayliqlarni, mesilen suni, imkaniyetning bariche tejep ishletmise bolmaydighan teghdirdin qutulalmaydu)

Afriqa & Jenubiy Amerika - Öpkening ikki qanati (Bu ikki qit'ediki keng tebiiy ormanliqlar yersharidiki asasliq oksigen teminligüchidur, elwette, yene dengiz asti ösümlüklirimu bar)

Rusiye & Mongghuliye - May toqulmasi (Rusiyening sherqidiki keng zimin we Mongghuliye Xelqaragha nisbeten mewjutluqimu bilinmey kelmekte)

Türkistan - Qan aylanish sistemasi (Türkiy döwletler Yawro-Asiya chong quruqluqining merkizige jaylashqan bolup, döwlettler arasidiki munasibet "dengiz zamani"din "quruqluq zamani"gha yötkiliwatqan bügünki künde, bu zimin qaytadin herqaysi döwletlerni tutashturidighan qatnash tügünige aylan'ghusi)

Germaniye & Yaponiye - Ashqazan & üchey (Bu ikki döwlet insaniyetning eqil-parasetini turmushta ishlitishke bolidighan mehsulatqa aylandurushta alahide iqtidargha ige)

Yawropadiki bashqa döwletler we Okyaniye - Ilik

Internet - Nerwa sistemasi

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Mr. Earth


I. N. Aptap


US & Canada - Cerebrum (These two countries absorbing first-class intellect power of the World by it's perpect legal system and democratic social environment)

UK - Pituitary (Despite of its small territory, the United Kingdom is the cradle of most of pioneer ideas)

Israel (Jews) - Glands (Hormons) (Jews  are sprinkled over the Earth, and they contributed their ability and wisdom to development of local economy and society, just like hormons done in human body)

Arabia & Iran - Liver (60% of world oil reserves are in this area)

India & China - Kidney (Ahalisi alahide köp bolghan bu ikki döwlet, qandaqla qilishidin qet'iy nezer, maddiy bayliqlarni, mesilen suni, imkaniyetning bariche tejep ishletmise bolmaydighan teghdirdin qutulalmaydu)

Africa & South America - Lungs (The original natural forest in this two continent are the main oxygen supplyer of the Earth, of course, sea plants is another source of oxygen)

Russia & Mongolia - Fat tissue (The vast territory of east part of Russia and Mongolia is a forgotten region for the World)

Turkistan - Circulatory system (Turkic nations are located in the center of Eurasia, and with the substitution of marin times by Continental Times, the Area would became a transport hub of the World again)

Germany & Japan - Stormach & Intestines (These two nations have special ability in aspect of change human intelligence into products of life necessities)

The other countries of the Europe & the Oceania - Marrow

Internet - Nervous system

{ Note: This is only a joke __ not a decision by the Congress of UN, that, Please dont be so serious about it!  }


Thursday, December 23, 2010

Uyghur Yeziqining Basma Shekli Ustide Izdinish

*
*
Eger siz Uyghur yéziqini tunji örginiwatqan kishi bolghiningizda, bu addiylashturulghan alipbe siz üchün qolayliq yaritidu: Siz peqet jedweldiki 33 herp sheklini örginiwalsingizla, Uyghur yéziqidin sawat chiqarghan bolisiz! Keynki mesile ashu 33 xil sheklni yézishni we shu asasta Uyghur yéziqidiki mezmunlarni oqushni meshq qilishla qalidu. 

Elwette, oqush jeryanida siz yene jedweldikige oxshimaydighan shekllerni (rastini éytqanda, sözlerning keynide kélidighan xilmu-xil "quyruq"larni) uchritishingiz mumkin, Xatirjem bolung, u quyruqlar hich isqa dexl qilmaydu, hemde siz emeliyet jeryanida ularnimu toluq tonuwalisiz!

The New York Times

Channel News Asia